Full pipeline


Step by step
(for 16S rRNA gene)




Information


How to start
  • Back to top
  • Upload files
  • Select metadata
  • Results
  • Browser compatibility

    • How to start the QINDAO


    1. Preparation of input files

      Example code

    2. Upload files

  • Shotgun metagenome
    • Click on 'Shotgun metagenome' in the analysis toolbar (A). Then, submit input files (①, ②, ③) and email address (optional).
    When submited these files, click on 'Chech files' to upload files and do a logical check (B).     input
    The format of the input file is shown below:
  • ① Taxonomic abundance (TSV file) 
    • clade_name      Sample1 Sample2 Sample3	...
d__Bacteria     100.0   100.0   100.0	...
d__Bacteria;p__Firmicutes       46.55688        60.60967        30.22924	...    
d__Bacteria;p__Bacteroidetes    36.42798        38.76096        45.40187	...  
d__Bacteria;p__Proteobacteria   12.1098 0.25673 1.27383	...
d__Bacteria;p__Actinobacteria   4.90178 0.37034 0.5293	...
...
  • ② KEGG Orthology abundance (TAV file) 
    • Gene_Family     SampleA SampleB SampleC	...
UNMAPPED        6349076.0       4530293.0       5450576.0	...
UNGROUPED       27764611.70766626       18977684.9287233        24501444.0289686	...
K00001  482.5132562369  0.0     14.4369586141	...
K00002  27.4016520096   0.0     0.0	...
K00003  209.4978357025  381.7850949708  627.0553335626	...
...
  • ③ Metadata (TSV file)
    Be sure to place the sample ID column in the first row in the metadata. 
    • 	Gender	Therapy	Response	...
SampleA	Female	CTLA-4 (Ipilimumab)	Responder	...
SampleB	Male	PD-1 (Pembrolizumab)	NonResponder	...
SampleC	Female	PD-1 (Pembrolizumab)	NonResponder	...
SampleD	Female	PD-1 (Pembrolizumab)	Responder	...
...
  • ④ Email address


  • 16S rRNA gene sequencing
    • Click on '16S rRNA gene' in the analysis toolbar (C). Then, submit input files (①, ②, ③, ④) and email address (optional).
    When submited these files, click on 'Chech files' to upload files and do a logical check (D).     input
    The format of the input file is shown below:
  • ① Taxonomic reads (BIOM file)
    BIOM files are binary and cannot be viewed in TSV format. Here you see the decoded version. ASV ID and sample ID must be unique. 
    • # Constructed from biom file
#ASV ID	SampleA	SampleB	SampleC	SampleD	...
7f3ad9a7e6609dfa371d22d4bd53fe96	716.0	699.0	408.0	580.0	...
504efe2f63f610a0f92e8cd040e2f916	51.0	98.0	96.0	91.0	...
5fc2ee02ce5c6a255df55093055d4793	112.0	29.0	45.0	35.0	...
47c305878bfc73bfeda34b2ae1a82ee1	0.0	0.0	0.0	0.0	...
8d7e1465fbc2323c5155ea4c76dd520c	56.0	4.0	63.0	131.0	...
...
  • ② Sequences (FASTA file) 
    • >7f3ad9a7e6609dfa371d22d4bd53fe96
TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTAAGTAAGACAGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTTGTGACTGCTTGACTGGAGTGTGTCAGAGGGAGGTGGAATTCCAAGTGTAGCAGTGAAATGCGTAGATATTTGGAAGAACACCGATGGCGAAGGCAGCCTCCTGGGATAACACTGACGCTCATGCACGAAAGCGTGGGGAGCAAACAGG
>504efe2f63f610a0f92e8cd040e2f916
TACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGAGACAAGTTGAATGTCTAAACTATCGGCTTAACTGATAGTCGCGTTCAAAACTATCACTCTTGAGTGCAGTAGAGGTAGGCGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAAGGCGGCCTACTGGGCTGTAACTGACGCTGAGGCTCGAAAGCGTGGGTAGCAAACAGG
...
  • ③ Taxonomy (TSV file) 
    • #ASV ID	Taxon
333bbf9224442fc10cd497377d2b1d01	d__Bacteria; p__Bacteroidota...
b15193fce14759d1c06728933e044af6	d__Bacteria; p__Bacteroidota...
df14354ec277348c54d0c9dd49eb4da0	d__Bacteria; p__Firmicutes...
...
  • ④ Metadata (TSV file)
    Be sure to place the sample ID column in the first row in the metadata. 
    • 	Gender	Therapy	Response	...
SampleA	Female	CTLA-4 (Ipilimumab)	Responder	...
SampleB	Male	PD-1 (Pembrolizumab)	NonResponder	...
SampleC	Female	PD-1 (Pembrolizumab)	NonResponder	...
SampleD	Female	PD-1 (Pembrolizumab)	Responder	...
...
  • ⑤ Email address


    • 3. Select metadata columns for comparison

    Check the column name(s) you wish to compare (E), and then check the data type for each metadata (F). Finaly, click on 'Submit.' (G) select

    4. Results

    You will be notified of the results by email. Please set up your e-mail settings to receive e-mails from 'w3qindao@gmail.com' How to interpret the results
    select

    5. Browser compatibility


    OS Version Chrome Firefox Microsoft Edge Safari
    Linux CentOS 7 not tested 91.9.0esr not tested n/a
    MacOS Catalina 108.0.5359.124 108.0.1 108.0.1462.54 15.6.1
    Windows 11 108.0.5359.124 91.12.0 108.0.1462.54 n/a